1. products
  2. clawed frog beta catenin positive control oligo

Gene Tools -Clawed Frog Beta Catenin Positive Control Oligo

SHARE

This carboxyfluoresceinated Morpholino oligo targets the Xenopus laevis Beta Catenin gene. This oligo acts as a positive control for knockdown of Beta Catenin in frog embryos.

  • Short Description :  Xenopus laevis Beta Catenin antisense oligo
  • Oligo sequence : TTTCAACCGTTTCCAAAGAACCAGG
  • Size and End-Modifications : 100 nmol with 3` Fluorescein
  • Molar Absorptivity : 262740.00
  • Molecular Weight : 8901.00
  • Harmonizing Code : 2934999000
  • Shipping Commodity Description : Synthetic non toxic reagent
  • Country of Origin : US
  • Physical Weight : 0.001 g
  • Restricted Item : Public
  • SKU: PCO-BetaCatenin-100-F