Gene Tools -Green Fluorescent Protein Positive Control
FromGene Tools, LLC
This Morpholino is a translation blocker targeting the first 25 bases of the coding sequence of one version of green fluorescent protein (GFP).
- Short Description : Translation blocker for GFP target
- Oligo sequence : ACAGCTCCTCGCCCTTGCTCACCAT
- Size and End-Modifications : 100 nmol
- Molar Absorptivity : 246420.00
- Molecular Weight : 8275.00
- Harmonizing Code : 2934999000
- Shipping Commodity Description : Synthetic non toxic reagent
- Country of Origin : US
- Physical Weight : 0.001 g
- Restricted Item : Public
- SKU: PCO-GFPControl-100