Gene Tools -Vivo-Morpholino GFP Positive Control
FromGene Tools, LLC
This Morpholino is a translation blocker targeting the first 25 bases of the coding sequence of one version of green fluorescent protein (GFP).
- Short Description ; Translation blocker for GFP target (Vivo-Morpholino)
- Oligo sequence : ACAGCTCCTCGCCCTTGCTCACCAT
- Size and End-Modifications : 100 nmol
- Molar Absorptivity : 246420.00
- Molecular Weight : 10085.00
- Harmonizing Code : 2934999000 : Shipping Commodity Description
- Synthetic non toxic reagent : Country of Origin : US
- Physical Weight : 0.001 g
- Restricted Item : Public
- SKU: PCO-VivoGFPControl-100